Overall information
FSDB ID EP1P0001 Type +1 frameshifting
Data EXPERIMENTAL Kingdom prokaryota
Definition Escherichia coli K12 MG1655 section 262 of 400 of the complete genome. 12144 bp DNA linear BCT 02-MAR-2001
Resource [1] Craigen WJ, Cook RG, Tate WP, Caskey CT. Proc Natl Acad Sci U S A. 1985 Jun;82(11):3616-20.
[2] Craigen WJ, Caskey CT. Nature. 1986 Jul 17-23;322(6076):273-5.
[3] Weiss RB, Dunn DM, Atkins JF, Gesteland RF. Cold Spring Harb Symp Quant Biol. 1987;52:687-93.
[4] Curran JF, Yarus M. J Mol Biol. 1988 Sep 5;203(1):75-83.
[5] Weiss RB, Dunn DM, Dahlberg AE, Atkins JF, Gesteland RF. EMBO J. 1988 May;7(5):1503-7.
[6] Adamski FM, Donly BC, Tate WP. Nucleic Acids Res. 1993 Nov 11;21(22):5074-8.
[7] Major LL, Poole ES, Dalphin ME, Mannering SA, Tate WP. Nucleic Acids Res. 1996 Jul 15;24(14):2673-8.
[8] Schwartz R, Curran JF. Nucleic Acids Res. 1997 May 15;25(10):2005-11.
[9] Persson BC, Atkins JF. J Bacteriol. 1998 Jul;180(13):3462-6.
[10] Baranov PV, Gesteland RF, Atkins JF. EMBO Rep. 2002 Apr;3(4):373-7. Epub 2002 Mar 15.
[11] Baranov PV, Gesteland RF, Atkins JF. Gene. 2002 Mar 20;286(2):187-201
Nucleic acid sequence AE000372
Amino acid sequence
gene
complement(10973..12071)
/gene="prfB"
/note="synonym: b2891"
CDS Click for details
Graphical view

12051
TAAATAATCGCATTCAGGACCTCACGGAACGCTCCGACGTTCTTA
GGGGG
TAT
CTTTGAC
Stop codons TAA (12051),
Signal
GGGGG (12006 - 12002)
Slippery sequence
CTTTGAC (11998 - 11992)
Model +1 prokaryote frameshift signal
FSFinder parameters

Run FSFinder
(You can obtain the above result by running FSFinder with the sequence and parameter values. You may have to alternate frames to get the same result.)
Target gene prfB gene
Sequence type Patial genome
Direction - strand
Signal
Match sequences

spacer

nt
Signal
Match sequences